Der genetische Fingerabdruck

Vorab: Diesen Blogartikel gibt es auch als Video. Einfach auf das nebenstehende Bild klicken und ihr werdet zu Youtube weitergeleitet.

Wie man es aus Krimis kennt, wird der genetische Fingerabdruck tatsächlich auch in der Strafverfolgung verwendet. Das ist allerdings nicht das einzige Einsatzgebiet, obendrein dient er auch zur Identifizierung von Leichen.

  • Überführung von Straftätern z.B. bei Morden, Vergewaltigungen oder Einbrüchen.
  • Identifikation von Leichen, wenn eine herkömmliche Identifizierung nicht mehr möglich ist. Beispiele dafür sind Brandopfer (Flugzeugabsturz, Industriebrand) oder auch Opfer von großen Naturkatastrophen mit Tausenden von Opfern. Bei manchen Tsunamis waren es zu viele Opfer, um sie in der notwendigen Schnelligkeit zu identifizieren. Deshalb werden in solchen Fällen DNA-Proben der Opfer genommen, diese begraben und erst anschließend nach und nach mit Hilfe des genetischen Fingerabdrucks identifiziert.

DNA

Der genetische Fingerabdruck wird mithilfe der DNA erstellt, deshalb folgen zu diesem Thema ein paar Fakten.

  • Unsere DNA liegt vorwiegend im Zellkern in zwei Strängen vor. Einen haben wir von unserer Mutter, einen vom Vater. Beide tragen dieselben Gene, aber mit unterschiedlichen Ausprägungen.
  • Die DNA aus einem Zellkern hätte eine Länge von zwei Metern, wenn wir sie entwirren und auseinanderziehen würden.
  • Die DNA eines einzelnen, menschlichen Körpers (also von allen Zellen) hat eine Länge die der 1000-fachen Distanz zwischen Erde und Sonne entspricht!
  • Mit der DNA der Einwohner Londons könnten wir die gesamte Milchstraße durchqueren.
  • Unsere DNA enthält etwa 23.000 Gene.
  • Das größte Genom (also den längsten DNA-Strang) hat die Japanische Einbeere Paris japonica, eine recht unscheinbare Pflanze, deren Genom etwa 50-mal größer als das des Menschen ist. Es gibt allerdings einen weiteren Thronanwärter, Polychaos dubium, eine Amöbe (also ein Einzeller). Es wird vermutet, dass dieses Tier ein mehr als 200-mal so großes Genom hat.
  • Die meisten Gene (31.000) hat, soweit bisher bekannt, Daphnia pulex, ein Wasserfloh.
  • Die Gene verteilen sich nicht gleichmäßig auf dem DNA-Strang. Tatsächlich beanspruchen sie nur etwa 5 %. Die restlichen 95 % bestehen aus sogenannter nichtcodierender DNA. Das ist allerdings ein heiß diskutiertes Feld in der Wissenschaft. Dafür spricht, dass eben vergleichsweise einfache Organismen, wie die japanische Einbeere oder die Amöbe Polychaos dubium ein deutlich größeres Genom haben. Die Logik diktiert somit, dass entsprechend große Teile ohne Funktion sind.

Der genetische Fingerabdruck

Beim genetischen Fingerabdruck wird nun ausschließlich die nichtcodierende DNA angeschaut. Dadurch erhalten die Wissenschaftler / Beamten keine weiteren Informationen über den jeweiligen Menschen. Man kann es durchaus mit dem normalen Fingerabdruck vergleichen. Durch diesen bin ich eindeutig zu identifizieren, aber man weiß nichts über mich als Person.

Wie identifiziert man aber nun eine Person, wenn man sich nur auf die informationslose, nichtcodierende DNA konzentriert?

In dieser kommt ein besonderes Phänomen vor, die sogenannten Short Tandem Repeats (im Folgenden STR abgekürzt). Dabei handelt es sich um kurze (short) Blöcke (tandem) von 2-4 Nucleotiden, die sich wiederholen (repeat).

Zur Erinnerung: Nucleotide sind die Bausteine der DNA. Es gibt davon vier verschiedene Adenin (A), Thymin (T), Cytosin (C) und Guanin (G), die sich im Doppelstrang zu Paaren zusammenfinden).

Von diesen STR gibt es sehr viele in der menschlichen DNA und einige davon wurden für den genetischen Fingerabdruck ausgewählt. Eine mögliche Nucleotid-Sequenz eines STR könnte also z.B. TAC lauten. Diese Sequenz des jeweiligen STR ist bei allen Menschen gleich – sie unterscheiden sich jedoch in der Anzahl der Wiederholungen. Bei STRs liegt die Wiederholungsrate zwischen 10 und 100.

Etwas komplizierter wird das Ganze dadurch, dass wir zwei DNA-Stränge haben. Dadurch besteht die Möglichkeit, dass die Anzahl der Wiederholungen sich zwischen den Strängen unterscheidet.

Bei Person X könnte also das TAC-STR folgendermaßen aussehen:

TACTACTACTACTACTACTACTACTACTACTACTACTACTACTAC (15 Wiederholungen)

TACTACTACTACTACTACTACTACTACTAC (10 Wiederholungen)

Bei Person Y dagegen:

TACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTAC (25 Wiederholungen)

TACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTAC (22Wiederholungen)

Wie wird das nun in der Praxis umgesetzt?

Findet man nun an einem Opfer Blut, das möglicherweise vom Täter stammt, dann wird davon eine Probe genommen. Im Labor wird bei dieser dann die DNA extrahiert und unser TAC-STR gezielt bei einer PCR (polymerase chain reaction) vervielfältigt.
Anschließend leitet man diese DNA durch ein sogenanntes Gel. Dabei handelt es sich um eine Masse, die an ein Mittelding zwischen Gummi und Wackelpudding erinnert. Große Moleküle wandern nur langsam durch das Gel – sie müssen sich erst mühsam den Weg suchen. Kleinere Moleküle wandern dagegen deutlich schneller.

Dadurch wird die DNA, die man in dem Gel sichtbar machen kann, praktisch nach ihrer Größe©Magnus Manske sortiert. Daneben lässt man eine sogenannte DNA-Leiter laufen. Das ist ein bunter Cocktail aus unterschiedlich großen DNA-Fragmenten. Wir wissen aber von jedem einzelnen Fragment, wie groß es ist. Das ist gut auf dem Bild (©Magnus Manske) zu erkennen. Links haben wir eine DNA-Leiter und recht sind die DNA-Proben, von der wir gerne die Größe wüssten.

Dadurch muss man am Ende nur noch ablesen, wie groß unser STR ist (und damit aus wie vielen Wiederholungen es besteht). Sollten wir auf unseren beiden DNA-Strängen eine unterschiedliche Anzahl von Wiederholungen dieses TAC-STR haben, würden wir zwei Banden sehen.

Gehen wir also zurück zu unserer Blutprobe. Nachdem wir das Gel haben laufen lassen und unser Ergebnis abgelesen haben, wissen wir nun, dass Blut von jemandem stammt, der 21 und 34 Wiederholungen des TAC-STR hat. Natürlich wurde auch das Blut des Opfers untersucht (43, 43), wodurch wir ausschließen können, dass es von eben diesem stammt.

Leider hat unser Verdächtiger 33 und 41 Wiederholungen, weshalb wir auch ihn ausschließen können und weitersuchen müssen.

Was hat es nun mit den Prozentangaben auf sich?

Man hört es im Fernsehen ja immer wieder. „Die Vaterschaft kann mit einer Wahrscheinlichkeit von 99,992 Prozent ausgeschlossen werden.“

Woher kommt diese Zahl aber nun?

Das ist eine rein mathematische Angelegenheit. Ich habe ja geschrieben, dass die Wiederholungsrate bei STRs zwischen 10 und 100 liegt. Das ist allerdings bei jedem STR unterschiedlich – manche haben nur eine Varianz von wenigen Wiederholungen, aber gehen wir man vom Maximum 10-100 aus.
Selbst wenn wir dabei die zwei verschiedenen DNA-Stränge berücksichtigen, ergeben sich nicht ausreichend Kombinationen, um einen Menschen eindeutig zu identifizieren (allein in Deutschland leben schließlich mehr als 80 Millionen Menschen).

Deshalb untersucht man nicht nur einen STR, sondern viele verschiedene. In Deutschland sind es üblicherweise 8 – 15. Der Rest ist dann reine Mathematik. Man weiß von jedem STR wie hoch die Varianz bei den Wiederholungen ist, wie die Wahrscheinlichkeitsverteilung ist (eine 23-fache Wiederholung muss nicht zwangsweise ebenso häufig vorkommen, wie eine 76-fache) und man kennt die Gesamtbevölkerung der Erde. Dadurch kann man dann berechnen, wie wahrscheinlich es ist, dass aktuell ein Mensch lebt, der dieselbe Kombination an Wiederholungen zeigt.

Ein paar abschließende Anmerkungen:

  • Auch wenn beim genetischen Fingerabdruck nur die nichtcodierende DNA analysiert wird, wird dabei auch eine Geschlechtsbestimmung vorgenommen. Dadurch fallen aber auch Abweichungen in der Chromosomenanzahl auf, wie sie z.B. beim Down-Syndrom vorkommt. Diese Art von Erkrankung würde also auch im Labor auffallen.
  • Ich habe nur STRs erwähnt. Beim genetischen Fingerabdruck werden allerdings auch andere Strukturen, wie VNTRs (dort ist der sich wiederholende Teil länger), untersucht. Das Prinzip ist aber immer dasselbe: Es geht um die Länge der Sequenz, also die Anzahl der Wiederholungen.
  • Der genetische Fingerabdruck wurde erstmals Mitte der 80iger in einem Kriminalfall verwendet. Damals brauchte man noch sehr viel DNA, die in einem guten Zustand vorliegen musste. Heute genügen schon winzige Mengen (wie Hautabriebe oder einzelne Haarwurzeln), um einen genetischen Fingerabdruck zu erhalten.
  • DNA ist recht empfindlich und denaturiert unter anderem bei Hitze und Sonnenlicht. Damals konnte es also sein, dass man mit Blutspuren nichts mehr anfangen konnte, wenn das Opfer stundenlang in der Sonne lag. Die Technik ist inzwischen aber so weit, dass dies kein Problem mehr ist.

Einige Quellen zum Nachlesen:

https://www.nsf.gov/news/news_summ.jsp?cntn_id=118530

http://phenomena.nationalgeographic.com/2013/02/06/you-have-46-chromsomes-this-pond-creature-has-15600/